2019-02-04 16:10:542019-02-04 16:10:10
The protein
Paralogous protein(s)
[[this]]
Biological materials
Mutant
GP1283 Δ(''[[gene|citA]]'')::''aphA3'', available in [SW|Jörg Stülke]'s lab
GP1753 Δ(''[[gene|citR]] [[gene|citA]]'')::''aphA3'', the resistance cassette can be cut out by introducing the ''cre''-rekombinase into the chromosom of ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
GP2360 Δ(''[[gene|citR]] [[gene|citA]])''::''erm'', the resistance cassette can be cut out by introducing the ''cre''-rekombinase into the chromosom of ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
BKE09430 (Δ[[gene|citR]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATTCTCCCTCTGA, downstream forward: _UP4_TAGGAGCAACCAAAACGCCT
BKK09430 (Δ[[gene|citR]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATTCTCCCTCTGA, downstream forward: _UP4_TAGGAGCAACCAAAACGCCT
GP1283 (''[[gene|citA]]''::''aphA3''), available in [SW|Jörg Stülke]'s lab
GP1753 (''[[gene|citR]] [[gene|citA]]''::''aphA3''), the resistance cassette can be cut out by introducing the ''cre''-rekombinase into the chromosom of ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
GP2360 (''[[gene|citR]] [[gene|citA]]''::''erm''), the resistance cassette can be cut out by introducing the ''cre''-rekombinase into the chromosom of ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
BKE09430 (Δ[[gene|citR]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATTCTCCCTCTGA, downstream forward: _UP4_TAGGAGCAACCAAAACGCCT
BKK09430 (Δ[[gene|citR]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTATTCTCCCTCTGA, downstream forward: _UP4_TAGGAGCAACCAAAACGCCT